View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7317_low_29 (Length: 254)
Name: NF7317_low_29
Description: NF7317
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7317_low_29 |
 | |
|
| [»] chr4 (2 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 118; Significance: 3e-60; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 118; E-Value: 3e-60
Query Start/End: Original strand, 91 - 254
Target Start/End: Complemental strand, 38062793 - 38062622
Alignment:
| Q |
91 |
acccaaatcaaaacctaatcacaaatgatttggttacaactaagtttcnnnnnnnttattttccaatttgaagtaaagttgataacgaactcataccctg |
190 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38062793 |
acccaaattaaaacctaatcacaaatgatttggttacaactaagtttcaaaaaaattattttccaatttgaagtaaagttgataacgaactcataccctg |
38062694 |
T |
|
| Q |
191 |
cccgacttgtc--------tagatttaattagcacgctttaatttaattaatctattatccacactactact |
254 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38062693 |
cccgacttgtctaccatattagatttaattagcacgctttaatttaattaatctattatccacactactact |
38062622 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 45 - 98
Target Start/End: Complemental strand, 38064244 - 38064191
Alignment:
| Q |
45 |
ccacagcgtgaaagtgtgcactccactgaatagtatgttgtcacctacccaaat |
98 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38064244 |
ccacagcgtgaaagtgtgcactccactgaatagtatgttgtcacctacccaaat |
38064191 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University