View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7317_low_32 (Length: 239)
Name: NF7317_low_32
Description: NF7317
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7317_low_32 |
 |  |
|
| [»] scaffold0014 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr1 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 15 - 221
Target Start/End: Original strand, 41363702 - 41363908
Alignment:
| Q |
15 |
tatggtccataaaaacttctaagtgatacactagtaatatggttgcttaatttaggagtctttatactacgtttattggcttcttctttctcattttcat |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41363702 |
tatggtccataaaaacttctaagtgatacactagtaatatggttgcttaatttaggagtctttatactacgtttattggcttcttctttctcattttcat |
41363801 |
T |
 |
| Q |
115 |
gttttgttgtcaattacggaactaacatcactaaagaaaaaccaaacatattgtgcttgctctcaccaattatgcctgaactagaaagcaatatgttaca |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41363802 |
gttttgttgtcaattacggaactaacatcactaaagaaaaaccaaacatattgtgcttgctctcaccaattatgcctgaactagaaagcaatatgttaca |
41363901 |
T |
 |
| Q |
215 |
gaattac |
221 |
Q |
| |
|
||||||| |
|
|
| T |
41363902 |
gaattac |
41363908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0014 (Bit Score: 64; Significance: 4e-28; HSPs: 1)
Name: scaffold0014
Description:
Target: scaffold0014; HSP #1
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 36 - 119
Target Start/End: Original strand, 69313 - 69396
Alignment:
| Q |
36 |
agtgatacactagtaatatggttgcttaatttaggagtctttatactacgtttattggcttcttctttctcattttcatgtttt |
119 |
Q |
| |
|
|||||||||||||| ||||| |||||||||||||||||||||||| || ||| ||||||||||||||||||||||||||||||| |
|
|
| T |
69313 |
agtgatacactagtgatatgtttgcttaatttaggagtctttatagtaagttgattggcttcttctttctcattttcatgtttt |
69396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 90 - 130
Target Start/End: Original strand, 20991230 - 20991271
Alignment:
| Q |
90 |
ttggcttcttctttctcattttcatg-ttttgttgtcaatta |
130 |
Q |
| |
|
||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
20991230 |
ttggcttcttcgttctcattttcatgtttttgttgtcaatta |
20991271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University