View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7317_low_39 (Length: 209)
Name: NF7317_low_39
Description: NF7317
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7317_low_39 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 66; Significance: 2e-29; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 66; E-Value: 2e-29
Query Start/End: Original strand, 87 - 152
Target Start/End: Complemental strand, 11616114 - 11616049
Alignment:
| Q |
87 |
cgtgggttgaatttacataaggtttattgattaacaatattagggtttgatttaagtatatttctt |
152 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11616114 |
cgtgggttgaatttacataaggtttattgattaacaatattagggtttgatttaagtatatttctt |
11616049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 17 - 59
Target Start/End: Complemental strand, 11616157 - 11616115
Alignment:
| Q |
17 |
attcttatttgatgaacatatgcatagatcttgagtggattaa |
59 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
11616157 |
attcttatttgatgaaaatatgcatagatcttgagtggattaa |
11616115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University