View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7319_high_23 (Length: 248)
Name: NF7319_high_23
Description: NF7319
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7319_high_23 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 146; Significance: 5e-77; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 9 - 169
Target Start/End: Complemental strand, 45684186 - 45684025
Alignment:
| Q |
9 |
tggtgttgctgtgaaactggtaatcccttgataaaattgtttaccaactcatcctttgatttaatgtattctataatatttatcagacataaatatccat |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45684186 |
tggtgttgctgtgaaactggtaatcccttgataaaattgtttaccaactcatcctttgatctaatgtattctataatatttatcagacataaatatccat |
45684087 |
T |
 |
| Q |
109 |
cgctttgtgc-ttttgatatttttgctctcacttttgaacctatttagtcttcgcacctgca |
169 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
45684086 |
cgctttgtgctttttgatatttttgctctcacttttgaacctatttagtcttcgcgcctgca |
45684025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University