View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7319_low_12 (Length: 387)
Name: NF7319_low_12
Description: NF7319
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7319_low_12 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 344; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 344; E-Value: 0
Query Start/End: Original strand, 1 - 376
Target Start/End: Complemental strand, 40557260 - 40556885
Alignment:
| Q |
1 |
cagtcaccattttccacttcttgaagcacatgtctttgtagagtataagattgggatccaacacggacacgtgcataccgacgatcttcttcctcccttt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||| || ||||||||||||||||| |
|
|
| T |
40557260 |
cagtcaccattttccacttcttgaagcacatgtctttgtagagtataagattgggatccaacacgaacacgggcataccaacaatcttcttcctcccttt |
40557161 |
T |
|
| Q |
101 |
tttcttttgaggcacataatccaaagacaattcctctgttggtgtcagaaagttctcttcaatcttacctattggaatggacaagcggctttgatctttg |
200 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40557160 |
tttattttgaggcacataatccaaagacaattcctctgttggtgtcagaaagttctcttcaatcttacctattggaatggacaagcggctttgatctttg |
40557061 |
T |
|
| Q |
201 |
tccacgtcactcattgtcagttccttctggatcaccaacttcacctcacaacctcccatttgttccatcttttctttaaacaccaatggaagctccggtt |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||| |||||||||||||||||| |
|
|
| T |
40557060 |
tccacgtcactcattgtcagttccttctggatcaccaacttcacctcacaaccttccatttgttcaatcttttctttaaacgccaatggaagctccggtt |
40556961 |
T |
|
| Q |
301 |
tctcttcttgcacctggttcttgcgtttctttgacggtttgcttgatcgttcattcttgtcttttcttttcttgat |
376 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40556960 |
tctcttcttgcacctggttcttgcgtttctttgacggtttgcttgatcgttcattcttgtcttttcttttcttgat |
40556885 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University