View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7319_low_31 (Length: 248)

Name: NF7319_low_31
Description: NF7319
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7319_low_31
NF7319_low_31
[»] chr2 (1 HSPs)
chr2 (9-169)||(45684025-45684186)


Alignment Details
Target: chr2 (Bit Score: 146; Significance: 5e-77; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 9 - 169
Target Start/End: Complemental strand, 45684186 - 45684025
Alignment:
9 tggtgttgctgtgaaactggtaatcccttgataaaattgtttaccaactcatcctttgatttaatgtattctataatatttatcagacataaatatccat 108  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
45684186 tggtgttgctgtgaaactggtaatcccttgataaaattgtttaccaactcatcctttgatctaatgtattctataatatttatcagacataaatatccat 45684087  T
109 cgctttgtgc-ttttgatatttttgctctcacttttgaacctatttagtcttcgcacctgca 169  Q
    |||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||    
45684086 cgctttgtgctttttgatatttttgctctcacttttgaacctatttagtcttcgcgcctgca 45684025  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University