View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7319_low_34 (Length: 241)
Name: NF7319_low_34
Description: NF7319
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7319_low_34 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 19 - 241
Target Start/End: Complemental strand, 42295640 - 42295417
Alignment:
| Q |
19 |
agtagtagttattatatcagctcatcatggctgagtgtgtgattctatcggctagagaatcaacaaatagaccatcattttagattnnnnnnnnnnccat |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
42295640 |
agtagtagttattatatcagctcatcatggctgagtgtgtgattctatcggctagagaatcaacaaatagaccatcattttagattaaaaaaaaa-ccat |
42295542 |
T |
 |
| Q |
119 |
caaaattatgnnnnnnnngtttt--gttaatcaagtatcctttgtgaacccttcaaaaaatttaacactgaagtatttacatggttgaatttaaataata |
216 |
Q |
| |
|
|||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
42295541 |
caaaattatgtttttttttttttttgttaatcaagtatcctttgtgaacccttcaaaaaatttaacactgaagtatttacatggttgaatttgaataata |
42295442 |
T |
 |
| Q |
217 |
ggatctatgatataaaccattattt |
241 |
Q |
| |
|
|||| |||||||||||||||||||| |
|
|
| T |
42295441 |
ggatatatgatataaaccattattt |
42295417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University