View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7319_low_36 (Length: 228)
Name: NF7319_low_36
Description: NF7319
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7319_low_36 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 207; Significance: 1e-113; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 1 - 211
Target Start/End: Original strand, 7238155 - 7238365
Alignment:
| Q |
1 |
caccatgcaaaacacgacaaatgactctaaaacaaacgaaaataagctttttagataatgtactttgtgtgttatcaattgcacgcctgtatattcatat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7238155 |
caccatgcaaaacacgacaaatgactctaaaacaaacgaaaataagctttttagataatgtactttgtgtgttatcaattgcacgcctgtatattcatat |
7238254 |
T |
 |
| Q |
101 |
cttatactcattacttgcactcttatttaccacaattcgttcataaaggcacacatagagttacacaacctttaatagttgcactccatctattcatctc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
7238255 |
cttatactcattacttgcactcttatttaccacaattcgttcataaaggcacacatagagttacacaacctttaatagttgcactccatctattcatccc |
7238354 |
T |
 |
| Q |
201 |
atatacccctt |
211 |
Q |
| |
|
||||||||||| |
|
|
| T |
7238355 |
atatacccctt |
7238365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 2 - 78
Target Start/End: Complemental strand, 1826372 - 1826295
Alignment:
| Q |
2 |
accatgcaaaacacgacaaatgactctaaaacaaacgaaaat-aagctttttagataatgtactttgtgtgttatcaa |
78 |
Q |
| |
|
||||||||| |||| | || ||||||||||||||| | | || ||||| |||||| |||||| ||||||||||||||| |
|
|
| T |
1826372 |
accatgcaagacacaataattgactctaaaacaaatggatatcaagctatttagacaatgtattttgtgtgttatcaa |
1826295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.00000008; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 2 - 35
Target Start/End: Original strand, 33994999 - 33995032
Alignment:
| Q |
2 |
accatgcaaaacacgacaaatgactctaaaacaa |
35 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| |
|
|
| T |
33994999 |
accatgcaaaacacgacaaatggctctaaaacaa |
33995032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 41
Target Start/End: Complemental strand, 29565855 - 29565815
Alignment:
| Q |
1 |
caccatgcaaaacacgacaaatgactctaaaacaaacgaaa |
41 |
Q |
| |
|
||||||| ||||| |||||||||||||||||||||| |||| |
|
|
| T |
29565855 |
caccatgtaaaacgcgacaaatgactctaaaacaaatgaaa |
29565815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University