View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7320_high_13 (Length: 460)
Name: NF7320_high_13
Description: NF7320
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7320_high_13 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 387; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 387; E-Value: 0
Query Start/End: Original strand, 20 - 441
Target Start/End: Original strand, 32726159 - 32726589
Alignment:
| Q |
20 |
gattggctgtgaagtggccgaatttgacgtaaggtgacatgtcttgaagtagttggaaagcagcaagtgtgtcgttttggttgtcgcggggaccatttgt |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
32726159 |
gattggctgtgaagtggccgaatttgacgtaaggtgacatgtcttgaagtagttggaaagcagcaagtgtgtcgttttggttgtcgtggggaccatttgt |
32726258 |
T |
 |
| Q |
120 |
ggtgaggtaatgtttgttgttgttgtggtgatggtggttattatgcgcacccccagcaccttctagtagtccatgaagggcttcggtgaaatgagcggca |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32726259 |
ggtgaggtaatgtttgttgttgttgtggtgatggtggttattatgcgcacccccagcaccttctagtagtccatgaagggcttcggtgaaatgagcggca |
32726358 |
T |
 |
| Q |
220 |
agtctctccatgttggagccgttagcatgttgtgagactaattccttgagccggatcaatatcactcgagctaagtcacggtttttggttgaaccggtta |
319 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32726359 |
agtctctccatgttggagccgttagcatgttgtgagactaattccttgagccggatcaatatcactcgagctaagtcacggtttttggttgaaccggtta |
32726458 |
T |
 |
| Q |
320 |
aggcttccgcgccagccatcaataggtgcactagttttagcccttttgaatcatcaccaacttcttgcgtttttattgtcgttgtt---------gttgt |
410 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||| ||||| |
|
|
| T |
32726459 |
aggcttccgcgccagccatcaataggtgcactagttttagcccttttgaatcatcaccaacttcatgcgtttttattgccgttgttgttgttgtggttgt |
32726558 |
T |
 |
| Q |
411 |
tgtttccatttcttcttcttcctcatccgtg |
441 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
32726559 |
tgtttccatttcttcttcttcctcatccgtg |
32726589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University