View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7320_high_27 (Length: 263)
Name: NF7320_high_27
Description: NF7320
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7320_high_27 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 1 - 243
Target Start/End: Complemental strand, 43091297 - 43091052
Alignment:
| Q |
1 |
atagaaagaaaaaa-gatgaagagtaggtgcagttagagagcatcataggt--atgtattaggtagtagtagggtgttggagatggaaaaaggaacaatg |
97 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43091297 |
atagaaagaaaaaaagatgaagagtaggtgcagttagagagcatcataggtgtatgtattaggtagtagtagggtgttggagatggaaaaaggaacaatg |
43091198 |
T |
 |
| Q |
98 |
ttgattcatctaaaaagctatcttttattggttcagctttaatgcataaaagtaacagaaccatattcagaagaaagaaagatgaattattcgatttctt |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43091197 |
ttgattcatctaaaaagctatcttttattggttcagctttaatgcataaaagtaacagaaccatattcagaagaaagaaagatgaattattcgatttctt |
43091098 |
T |
 |
| Q |
198 |
tttacgagtcacacaatcacaaactgtttctttgatttagggagtt |
243 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
43091097 |
tttacgagtcacacaatcacaaactttttctttgatttagggagtt |
43091052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University