View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7320_high_31 (Length: 249)
Name: NF7320_high_31
Description: NF7320
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7320_high_31 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 1 - 242
Target Start/End: Complemental strand, 52074715 - 52074482
Alignment:
| Q |
1 |
aacgaaaagtgaatgaaagagaagaaaataaagcaaaacaaactgagcgaagcttcttttattattctctcgaatcgatcgatccatccaccttttaatt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
52074715 |
aacgaaaagtgaatgaaagagaagaaaataaagcaaaacaaactgagcgaagcttcttttattattctctcgaatcgatcgatccat------------t |
52074628 |
T |
|
| Q |
101 |
tatttttctctatctgctctttgtctttgtctgttttccgttattttattcattcattcgtttatgcgcttaatttcacacccttaggtgtgtgccacgt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52074627 |
tatttttctctatctgctctttgtctttgtctgttttccgttattttattcattcattcgtttatgcgcttaatttcacacccttaggtgtgtgccacgt |
52074528 |
T |
|
| Q |
201 |
gtctatttttatcgcacccctccc----tcccatcatttcatctct |
242 |
Q |
| |
|
||||||||||||| |||||||||| |||||||||||||||||| |
|
|
| T |
52074527 |
gtctatttttatcacacccctccctccctcccatcatttcatctct |
52074482 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University