View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7320_high_37 (Length: 241)
Name: NF7320_high_37
Description: NF7320
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7320_high_37 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 22 - 227
Target Start/End: Complemental strand, 8789689 - 8789483
Alignment:
| Q |
22 |
ataatattctcaacacttacacttcagatcgaagatgtgtccggtgtaggtgtccgtcactaacacggcacacatacttatagttacgttgtaatttctt |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8789689 |
ataatattctcaacacttacacttcagatcgaagatgtgtccggtgtaggtgtccgtcactaacacggcacacatacttatagttacgttgtaatttctt |
8789590 |
T |
|
| Q |
122 |
aaattataatcgatgtcagtgtc-gtgtccagttggatcaatgcatgtatatgattatggaacaatgaaacgtacctttttgaagacaagtctatctggg |
220 |
Q |
| |
|
||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8789589 |
aaattataatcgatgtcagtgtcagtgtctggttggatcaatgcatgtatatgattatggaacaatgaaacgtacctttttgaagacaagtctatctggg |
8789490 |
T |
|
| Q |
221 |
gaaataa |
227 |
Q |
| |
|
||||||| |
|
|
| T |
8789489 |
gaaataa |
8789483 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University