View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7320_low_19 (Length: 425)
Name: NF7320_low_19
Description: NF7320
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7320_low_19 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 132; Significance: 2e-68; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 132; E-Value: 2e-68
Query Start/End: Original strand, 268 - 407
Target Start/End: Complemental strand, 9135475 - 9135336
Alignment:
| Q |
268 |
aaaccctaaaaaacaaacccttttcgaaaacatgggacaaaggatctcttcttgcattcacccacaagctgcttgttccaattcggtttctccattttat |
367 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9135475 |
aaaccctaaaaaacaaaccctttttgaaaacatgggacaaaggatctcttcttgcattcacccacaagctgcttgttccaattcggtttctccattttat |
9135376 |
T |
|
| Q |
368 |
gctgattgtcaaaaattgaaaccacaagaacaagatcctt |
407 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
9135375 |
gctgattgtcaaaaactgaaaccacaagaacaagatcctt |
9135336 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 93; E-Value: 4e-45
Query Start/End: Original strand, 141 - 233
Target Start/End: Complemental strand, 9135599 - 9135507
Alignment:
| Q |
141 |
ggatccttgttgagcaagtaacgttgatttataaccgcgttagcgtacgaaacagaaattgtctcactctcacttcagtcacaactctttcaa |
233 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9135599 |
ggatccttgttgagcaagtaacgttgatttataaccgcgttagcgtacgaaacagaaattgtctcactctcacttcagtcacaactctttcaa |
9135507 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University