View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7320_low_47 (Length: 223)

Name: NF7320_low_47
Description: NF7320
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7320_low_47
NF7320_low_47
[»] chr3 (1 HSPs)
chr3 (20-204)||(48450597-48450781)


Alignment Details
Target: chr3 (Bit Score: 173; Significance: 3e-93; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 173; E-Value: 3e-93
Query Start/End: Original strand, 20 - 204
Target Start/End: Original strand, 48450597 - 48450781
Alignment:
20 tactatgtccacgtgttccatgtataatagcatcgacctgtttgatgctttttgttgaagagctaattatgtggtctcccctggattaattttgttgaat 119  Q
    |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
48450597 tactatgtccacgtgttccatgtataatagcaacgacctgtttgatgctttttgttgaagagctaattatgtggtctcccctggattaattttgttgaat 48450696  T
120 gacaacttttgctgtcttctatctatgttatgtggttaggaaataagttatgaagcagttcataacgagttacctttgtttgaag 204  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||    
48450697 gacaacttttgctgtcttctatctatgttatgtggttaggaaataagttatgaagcagttgataacgaggtacctttgtttgaag 48450781  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University