View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7321_low_17 (Length: 485)
Name: NF7321_low_17
Description: NF7321
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7321_low_17 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 464; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 464; E-Value: 0
Query Start/End: Original strand, 1 - 468
Target Start/End: Complemental strand, 37632238 - 37631771
Alignment:
| Q |
1 |
ttttccccttgcaaatttctcgcactttccatctccccaattgcatcgttttcctccaccatgggccttgcagaaatctgtgctcccttgagcactcttc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37632238 |
ttttccccttgcaaatttctcgcactttccatctccccaattgcatcgttttcctccaccatgggccttgcagaaatctgtgctcccttgagcactcttc |
37632139 |
T |
 |
| Q |
101 |
ccacagctttcaaacttgcagcgtttacccccgccatgcctaacacaacagtcggtacggccacgtgcactcttggtgcaaccggaaacagcacacctct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37632138 |
ccacagctttcaaacttgcagcgtttacccccgccatgcctaacacaacagtcggtacggccacgtgcactcttggtgcaaccggaaacagcacacctct |
37632039 |
T |
 |
| Q |
201 |
ttccaccaccatgagcaacacaaaagtttgttcctccgtgtacgctttttggacaaataccaccaccattgaaaaggcaacgcttgcctccaccgtgggc |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37632038 |
ttccaccaccatgagcaacacaaaagtttgttcctccatgtacgctttttggacaaataccaccaccattgaaaaggcaacgcttgcctccaccgtgggc |
37631939 |
T |
 |
| Q |
301 |
cttgcatagtggggtgcttccttcagcacctttggtgcacccagcaaatgagcaacgcttcccaccaccatgtgccttgcaaaacatggtgctcccttgt |
400 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37631938 |
cttgcatagtggggtgcttccttcagcacctttggtgcacccagcaaatgagcaacgcttcccaccaccatgtgccttgcaaaacatggtgctcccttgt |
37631839 |
T |
 |
| Q |
401 |
gcaccctttgaacattcgcgatactgacaacggcgtccacccccatgggagatgcacagcccagcttg |
468 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37631838 |
gcaccctttgaacattcgcgatactgacaacggcgtccacccccatgggagatgcacagcccagcttg |
37631771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 52; Significance: 1e-20; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 167 - 402
Target Start/End: Original strand, 41631813 - 41632048
Alignment:
| Q |
167 |
gcactcttggtgcaaccggaaacagcacacctctttccaccaccatgagcaacacaaaagtttgttcctccgtgtacgctttttggacaaataccaccac |
266 |
Q |
| |
|
|||||||| ||||| || | |||||||||||||||||||||||||| || ||||||||||| || ||||| || || ||||| | ||||| ||||||| |
|
|
| T |
41631813 |
gcactctttgtgcagcctgctacagcacacctctttccaccaccatgtgccacacaaaagttggtacctccatgaacacttttagtgcaaattccaccac |
41631912 |
T |
 |
| Q |
267 |
cattgaaaaggcaacgcttgcctccaccgtgggccttgcatagtggggtgcttccttcagcacctttggtgcacccagcaaatgagcaacgcttcccacc |
366 |
Q |
| |
|
| | | | ||||| ||||| ||||| ||| |||| || | |||||||| || |||||||| || |||||||| | || || || ||||| || |
|
|
| T |
41631913 |
cctggtaggtacaacgtttgcccccaccatggcccttacaaaagggggtgctcccctcagcacccttagtgcaccctggtgctgtacaccgtttccctcc |
41632012 |
T |
 |
| Q |
367 |
accatgtgccttgcaaaacatggtgctcccttgtgc |
402 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||| |
|
|
| T |
41632013 |
accatgtgctttgcaaaacatggtgctcccttgtgc |
41632048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University