View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7321_low_22 (Length: 405)
Name: NF7321_low_22
Description: NF7321
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7321_low_22 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 398; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 398; E-Value: 0
Query Start/End: Original strand, 4 - 405
Target Start/End: Complemental strand, 34079235 - 34078834
Alignment:
| Q |
4 |
ggagcaactagggcagtcacagactaccatgtctcaaaatgctattaccttgccaccatttcctggtagggagtgtgctatagaagggaacaccgatcca |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34079235 |
ggagcaactagggcagtcacagactaccatgtctcaaaatgctattaccttgccaccatttcctggtagggagtgtgctatagaagggaacaccgatcca |
34079136 |
T |
|
| Q |
104 |
caaaaccatcttttgtttggttttaacatagagccctcatcacatctagtttacagtgagatgtctaaccttaagagggtcaatagcaactgtgactcat |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34079135 |
caaaaccatcttttgtttggttttaacatagagccctcatcacatctagtttacaatgagatgtctaaccttaagagggtcaatagcaactgtgactcat |
34079036 |
T |
|
| Q |
204 |
caactgcaccttttcaatcttccacctacttgaataccacaggtgctgattcttcactgaatcctggattgacacacggcgttggtgagtcgggcttcat |
303 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34079035 |
caactgcaccttttcaatcttccacctacttgaataccacaggtgctgattcttcactgaatcctggattgacacacggcgttggtgagtcgggcttcat |
34078936 |
T |
|
| Q |
304 |
gcaaactccagaaaatggaggtcaaggaaacccacaaaacaaaacctttgtgaaggtgagctttttatgctgggactaatctctttcgaaccaacatttt |
403 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34078935 |
gcaaactccagaaaatggaggtcaaggaaacccacaaaacaaaacctttgtgaaggtgagctttttatgctgggactaatctctttcgaaccaacatttt |
34078836 |
T |
|
| Q |
404 |
ga |
405 |
Q |
| |
|
|| |
|
|
| T |
34078835 |
ga |
34078834 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 47; Significance: 1e-17; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 4 - 78
Target Start/End: Complemental strand, 5907661 - 5907587
Alignment:
| Q |
4 |
ggagcaactagggcagtcacagactaccatgtctcaaaatgctattaccttgccaccatttcctggtagggagtg |
78 |
Q |
| |
|
|||||| ||||||||| ||| || | | |||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
5907661 |
ggagcagctagggcaggcacggaattcgatgtctcaaaatgctattacattgccaccatttcctggtagggagtg |
5907587 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University