View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7321_low_28 (Length: 364)
Name: NF7321_low_28
Description: NF7321
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7321_low_28 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 323; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 323; E-Value: 0
Query Start/End: Original strand, 11 - 350
Target Start/End: Complemental strand, 9796550 - 9796205
Alignment:
| Q |
11 |
aagaatggcaccagggaattgttgcagctctgaggtagcagctacattaagtgtgtgttccatcatggaagatcaaaatgatgataccttggggagtttg |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9796550 |
aagaatggcaccagggaattgttgcagctctgaggtagcagctacattaagtgtgtgttccatcatggaagatcaaaatgatgataccttggggagtttg |
9796451 |
T |
 |
| Q |
111 |
aatcagaatgttgttgggaagcctccaagggatcattctgccactatgcgtcattgcagcagctcttcatggctcgttgattcggtaaggactgaatctc |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9796450 |
aatcagaatgttgttgggaagcctccaagggatcattctgccactatgcgtcattgcagcagctcttcatggctcgttgattcggtaaggactgaatctc |
9796351 |
T |
 |
| Q |
211 |
agtagatcgtgacaacaagaatactatgtcattatatgttcatttgtatttgt------attttgttaatagtgttaattaacaattatgtcttattcta |
304 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9796350 |
agtagatcgtgacaacaagaatactatgtcattatatgttcatttgtatttgtatttgtattttgttaatagtgttaattaacaattatgtcttattcta |
9796251 |
T |
 |
| Q |
305 |
tattgtggctataggaatcaaatcttaatactattgttggccttaa |
350 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9796250 |
tattgtggctataggaatcaaatcttaatactattgttggccttaa |
9796205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University