View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7321_low_29 (Length: 331)
Name: NF7321_low_29
Description: NF7321
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7321_low_29 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 285; Significance: 1e-160; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 285; E-Value: 1e-160
Query Start/End: Original strand, 1 - 318
Target Start/End: Complemental strand, 7271087 - 7270770
Alignment:
| Q |
1 |
cttttacttccccttttttcttctatcgctattcttagaagaagaaccttgatttaatttcttcaaaatcggtggtgggtttcttttctagcttgtttta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7271087 |
cttttacttccccttttttcttctatcgctattcttagaagaagaaccttgatttaatttcttcaaaatcggtggtgggtttcttttctagcttgtttta |
7270988 |
T |
 |
| Q |
101 |
aatagattgcagctaagttgtttatcagactcaaatgggttagaagggacagttatggtgttgttgctgagaagaaaattgtttaatnnnnnnncgaaaa |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
7270987 |
aatagattgcagctaagttgtttatcagactcaaatgggttagaagggacaattatggtgttgttgctgagaagaaaattgtttaataaaaaaacgaaaa |
7270888 |
T |
 |
| Q |
201 |
cgagtggatgatgatgatgaagattttggggattttaatctctttatgttggtttgttttggctttgatttgataaatgtagtgaaataaaatttggatt |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
7270887 |
cgagtggatgatgatgatgaagattttggggattttaatctctttatgttggtttgttttggatttgatttgataaatgtagtgaaatgaaatttggatt |
7270788 |
T |
 |
| Q |
301 |
ttctatctcttttaatga |
318 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
7270787 |
ttctatctcttttaatga |
7270770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University