View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7321_low_40 (Length: 251)
Name: NF7321_low_40
Description: NF7321
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7321_low_40 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 14 - 251
Target Start/End: Complemental strand, 41677605 - 41677368
Alignment:
| Q |
14 |
aatatcaaaaataaaataaaatgatgtcttccctttttaagtgtatatatggttactttccttttttaagtcataactagctgcgaaaagttgtcacatg |
113 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
41677605 |
aatatcaaaaataaaataaaatgatgttttccctttttaaatgtatatatggttactttccttttttaagtcacaactagctgcgaaaagttgtcacatg |
41677506 |
T |
 |
| Q |
114 |
cgttgtgagtttgtgagtggcggtggggttgtaaacgctctggagttgcgcgtatggtccaacacttttccaaccgtccttcttctgtacataccattgg |
213 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41677505 |
cgttgtgagtttgtgagtggcggtggtgttgtaaacgctctggagttgcgcgtatagtccaacacttttccaaccgtccttcttctgtacataccattgg |
41677406 |
T |
 |
| Q |
214 |
tttttctgcttccttcgtctcttgtctttattgttgtt |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41677405 |
tttttctgcttccttcgtctcttgtctttattgttgtt |
41677368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University