View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7321_low_48 (Length: 230)
Name: NF7321_low_48
Description: NF7321
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7321_low_48 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 194; Significance: 1e-105; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 1 - 219
Target Start/End: Complemental strand, 22684332 - 22684112
Alignment:
| Q |
1 |
ctacaactgtaattgcgactgcaata--aaggttttagagatctcctaaacgccaattgtgaccgcaattgcggccacatttgctcaagttttgtagcat |
98 |
Q |
| |
|
||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
22684332 |
ctacaactgtaattgcggctgcaatataaaggttttagagatctcctaaacgccaattgtgaccgcaattgcagccacatttgctcaagttttgtagcat |
22684233 |
T |
 |
| Q |
99 |
attggtgtcttacttgccaatatgttactcactatcgcaggaagcaagttataatgacaaagagaatgaatttgcagtgtttaattaatgctttatttgt |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22684232 |
attggtgtcttacttgccaatatgttactcactatcgctggaagcaagttataatgacaaagagaatgaatttgcagtgtttaattaatgctttatttgt |
22684133 |
T |
 |
| Q |
199 |
ttaaatttaccacaggttctg |
219 |
Q |
| |
|
| ||||||||||||||||||| |
|
|
| T |
22684132 |
tcaaatttaccacaggttctg |
22684112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 1 - 92
Target Start/End: Complemental strand, 22695815 - 22695722
Alignment:
| Q |
1 |
ctacaactgtaattgcgactgcaata--aaggttttagagatctcctaaacgccaattgtgaccgcaattgcggccacatttgctcaagttttg |
92 |
Q |
| |
|
||||||||||||||||| |||| ||| ||||||||||||||||||| ||| || |||||||||||||||| |||||||||||| |||||||| |
|
|
| T |
22695815 |
ctacaactgtaattgcggctgcgatataaaggttttagagatctcctctacggcagttgtgaccgcaattgcagccacatttgctaaagttttg |
22695722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 146 - 219
Target Start/End: Complemental strand, 22695596 - 22695522
Alignment:
| Q |
146 |
gttataatgacaaagagaat-gaatttgcagtgtttaattaatgctttatttgtttaaatttaccacaggttctg |
219 |
Q |
| |
|
|||||||||||||||| ||| || ||| | |||| ||||| |||||||||||||| |||||||| ||||||||| |
|
|
| T |
22695596 |
gttataatgacaaagacaatagatttttcggtgtgtaattgatgctttatttgttcaaatttactgcaggttctg |
22695522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University