View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7321_low_50 (Length: 220)
Name: NF7321_low_50
Description: NF7321
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7321_low_50 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 19 - 204
Target Start/End: Original strand, 46464655 - 46464841
Alignment:
| Q |
19 |
aattctctaaatgtgcatataaacgtgcacattagtttaatctaagtggatgactaatttctccctnnnnnnn-gaaaagtatcattaatttcagaataa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
46464655 |
aattctctaaatgtgcatataaacgtgcacattagtttaatctaagtggatgactaatttctccctaaaaaaaagaaaaatatcattaatttcagaataa |
46464754 |
T |
|
| Q |
118 |
ttggaacttcggtcagcagagtatatatgtagctttgatcatcaatataccaaacacaatcatattacacattctccttttatgata |
204 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46464755 |
ttggaactttggtcagcagagtatatatgtagctttgatcatcaatataccaaacacaatcatattacacattctccttttatgata |
46464841 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University