View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7321_low_51 (Length: 219)
Name: NF7321_low_51
Description: NF7321
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7321_low_51 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 121; Significance: 4e-62; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 13 - 158
Target Start/End: Original strand, 7271064 - 7271209
Alignment:
| Q |
13 |
agaagaaaaaaggggaagtaaaagtagagtagaaaagaaacccaccacctagctccttcggttactttgattttgttttgatttctaaacatttgaactg |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7271064 |
agaagaaaaaaggggaagtaaaagtagagtagaaaataaacccaccacctagctccttcggttactttgattttgttttgatttctaaacatttgaactg |
7271163 |
T |
 |
| Q |
113 |
nnnnnnnaatgggttttatttatgggtggtgttgaagttcaatgga |
158 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7271164 |
tttttttaatgggttttatttatgggtggtgttgaagttcaatgga |
7271209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University