View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7322_high_10 (Length: 244)
Name: NF7322_high_10
Description: NF7322
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7322_high_10 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 20 - 237
Target Start/End: Complemental strand, 35441229 - 35441012
Alignment:
| Q |
20 |
tatctttgatggagacaaaggtggtgttgttgatgcagactcgactcctacattcttcttttctgccttcttttttagttcaatgcaagcttgactcacc |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35441229 |
tatctttgatggagacaaaggtggtgttgttgatgcagactcaactcctacattcttcttttctgccttcttttttagttcaatgcaagcttgactcacc |
35441130 |
T |
 |
| Q |
120 |
atttcaacaaaatcttttacaatcacaaacaaatgaaaaggattgggcatattgtcttttgatgctcctgctagatagtactcatttgttttcttcacaa |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35441129 |
atttcaacaaaatcttttacaatcacaaacaaatgaaaaggattaggcatattgtcttttgatgctcctgctagatagtactcatttgttttcttcacaa |
35441030 |
T |
 |
| Q |
220 |
gttccattatctttgttt |
237 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
35441029 |
gttccattatctttgttt |
35441012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University