View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7322_high_11 (Length: 222)
Name: NF7322_high_11
Description: NF7322
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7322_high_11 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 137; Significance: 1e-71; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 62 - 205
Target Start/End: Complemental strand, 54572531 - 54572387
Alignment:
| Q |
62 |
tatttttgataactgagaaagtgtgaatgggg-attcatggaggaatgaaaatcaatgatatagatttgtcagtcctaaccaatgattcatggagaccct |
160 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54572531 |
tatttttgataactgagaaagtgtgaatgggggattcatggaggaatgaaaatcaatgatatagatttgtcagtcctaaccaatgattcatggagaccct |
54572432 |
T |
|
| Q |
161 |
atgcattttgcaatgaaattctatcccaaagtatataaggctctt |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54572431 |
atgcattttgcaatgaaattctatcccaaagtatataaggctctt |
54572387 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 62 - 205
Target Start/End: Complemental strand, 55155798 - 55155654
Alignment:
| Q |
62 |
tatttttgataactgagaaagtgtgaatgg-ggattcatggaggaatgaaaatcaatgatatagatttgtcagtcctaaccaatgattcatggagaccct |
160 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55155798 |
tatttttgataactgagaaagtgtgaatggaggattcatggaggaatgaaaatcaatgatatagatttgtcagtcctaaccaatgattcatggagaccct |
55155699 |
T |
|
| Q |
161 |
atgcattttgcaatgaaattctatcccaaagtatataaggctctt |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55155698 |
atgcattttgcaatgaaattctatcccaaagtatataaggctctt |
55155654 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 62 - 148
Target Start/End: Complemental strand, 4097355 - 4097269
Alignment:
| Q |
62 |
tatttttgataactgagaaagtgtgaatggggattcatggaggaatgaaaatcaatgatatagatttgtcagtcctaaccaatgatt |
148 |
Q |
| |
|
|||||||||||||| |||||| |||||||||||||| | ||||||| |||||||||||| ||||||| |||||||||| |||||||| |
|
|
| T |
4097355 |
tatttttgataactcagaaagcgtgaatggggattctttgaggaatcaaaatcaatgatttagatttctcagtcctaatcaatgatt |
4097269 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University