View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7322_high_7 (Length: 290)
Name: NF7322_high_7
Description: NF7322
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7322_high_7 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 140; Significance: 2e-73; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 1 - 140
Target Start/End: Complemental strand, 46213193 - 46213054
Alignment:
| Q |
1 |
aaagagaaagagaaaggctttgaaaaatgatatggttcttttctttccctcgctttcctttggttcaatgtcgtgttctatattggtgtttcacccgaac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46213193 |
aaagagaaagagaaaggctttgaaaaatgatatggttcttttctttccctcgctttcctttggttcaatgtcgtgttctatattggtgtttcacccgaac |
46213094 |
T |
 |
| Q |
101 |
ctgcttccgaccctctcgctatgtcatcacttaatcatgg |
140 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46213093 |
ctgcttccgaccctctcgctatgtcatcacttaatcatgg |
46213054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 220 - 290
Target Start/End: Complemental strand, 46212975 - 46212906
Alignment:
| Q |
220 |
caaaacttttgcagatacaaccaattattatgtcaannnnnnnnataaaaataaaatacttttattatatt |
290 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
46212975 |
caaaacttttgcagatacaaccaattattatgtcaa-tttttttataaaaataaaatacttttattatatt |
46212906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University