View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7322_low_14 (Length: 270)
Name: NF7322_low_14
Description: NF7322
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7322_low_14 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 163; Significance: 4e-87; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 163; E-Value: 4e-87
Query Start/End: Original strand, 1 - 216
Target Start/End: Complemental strand, 43725733 - 43725517
Alignment:
| Q |
1 |
tcgaatctttatgtttgtannnnnnnagaaggacttgggtgaagttcccctaaggtcctaattcaactatattaatctaaataatttgatgaaaagtcct |
100 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
43725733 |
tcgaatctttatgtttgtatttttttagaaggacttgggtgaagttcccctaaggtcctaattcaactatattaatctaaataatttgataaaaagtcct |
43725634 |
T |
|
| Q |
101 |
aattcctagatgtgatgggagaattannnnnnnattaggaattatg-tgccctaaactggaaaggcctatgaaaagatgattccacatacgatgcagcaa |
199 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43725633 |
aattcctagatgtgatgggagaattatttttttattaggaattatgctgccctaaactggaaaggcctatgaaaagatgattccacatacgatgcagcaa |
43725534 |
T |
|
| Q |
200 |
aagagcactatcttgtg |
216 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
43725533 |
aagagcactatcttgtg |
43725517 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University