View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7322_low_20 (Length: 210)
Name: NF7322_low_20
Description: NF7322
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7322_low_20 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 84; Significance: 4e-40; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 84; E-Value: 4e-40
Query Start/End: Original strand, 17 - 100
Target Start/End: Original strand, 27838660 - 27838743
Alignment:
| Q |
17 |
tggtggtgtaggtggacatggaggaggagcggggggaggtgaaggtgcaggtggtggtgctggatatggagatgatgctgttgt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27838660 |
tggtggtgtaggtggacatggaggaggagcggggggaggtgaaggtgcaggtggtggtgctggatatggagatgatgctgttgt |
27838743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University