View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7322_low_6 (Length: 398)
Name: NF7322_low_6
Description: NF7322
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7322_low_6 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 175; Significance: 4e-94; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 175; E-Value: 4e-94
Query Start/End: Original strand, 14 - 200
Target Start/End: Complemental strand, 38999972 - 38999786
Alignment:
| Q |
14 |
cacacacgttgcttgttcctcaattcatggattgatcaaacaaatgtcttcaatctacatgttaatctagtagtatacataatggattgatcgaacatca |
113 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38999972 |
cacacacattgcttgttcctcaattcatggattgatcaaacaaatgtcttcaacctacatgttaatctagtagtatacataatggattgatcgaacatca |
38999873 |
T |
|
| Q |
114 |
tgttatcattcattctactaggtgagaatactcttttcatgttcttaagtcctttacatattttctctctttccattgatttgtagc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38999872 |
tgttatcattcattctactaggtgagaatactcttttcatgttctttagtcctttacatattttctctctttccattgatttgtagc |
38999786 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 112; E-Value: 2e-56
Query Start/End: Original strand, 266 - 385
Target Start/End: Complemental strand, 38999625 - 38999506
Alignment:
| Q |
266 |
gtgtcccaaagggtgcaggaattggataaattaatggttcaacattgatgaacagacatacaaggcaaaaacattgattagaatggattcattcaatcag |
365 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38999625 |
gtgtcccaaagggtgcaggaattggataatttaatggttcaacattgatgaacagacattcaaggcaaaaacattgattagaatggattcattcaatcag |
38999526 |
T |
|
| Q |
366 |
agtcatcaaaacaacaactt |
385 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
38999525 |
agtcatcaaaacaacaactt |
38999506 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University