View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7323_high_11 (Length: 306)

Name: NF7323_high_11
Description: NF7323
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7323_high_11
NF7323_high_11
[»] chr5 (3 HSPs)
chr5 (159-292)||(9436959-9437092)
chr5 (1-86)||(9437165-9437250)
chr5 (1-54)||(33758579-33758632)
[»] chr7 (3 HSPs)
chr7 (171-292)||(15118245-15118366)
chr7 (1-54)||(15118080-15118133)
chr7 (2-46)||(10004338-10004382)
[»] chr2 (2 HSPs)
chr2 (194-292)||(5051932-5052030)
chr2 (1-40)||(7694669-7694708)
[»] chr4 (3 HSPs)
chr4 (1-83)||(50590359-50590441)
chr4 (184-247)||(50590200-50590263)
chr4 (1-53)||(51406918-51406970)
[»] chr3 (1 HSPs)
chr3 (1-51)||(51056081-51056131)


Alignment Details
Target: chr5 (Bit Score: 118; Significance: 3e-60; HSPs: 3)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 118; E-Value: 3e-60
Query Start/End: Original strand, 159 - 292
Target Start/End: Complemental strand, 9437092 - 9436959
Alignment:
159 gcagatctgtaaatcctttgtgtgagtttggttttgggtggtcatagaccgccgacggcctttggtgtagttccaaggtggcggtggttcggtggtggat 258  Q
    |||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||    
9437092 gcagatatgtaaatcctttgtgtgagtttggttttgggtggtcgtagaccgccgacggcctttggtgtagttccaaggtggcggtggtttggtggtggat 9436993  T
259 atgggttgtacaacaccctttctcggtggtgatg 292  Q
    |||||||| |||||||||||||||||||||||||    
9436992 atgggttgcacaacaccctttctcggtggtgatg 9436959  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 1 - 86
Target Start/End: Complemental strand, 9437250 - 9437165
Alignment:
1 gtggtggtgtgacggtcggctttagccatccgcaccaccctttctagatctcccaaaggttgctgcatcggtgaactgtggttatt 86  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||    
9437250 gtggtggtgtgacggtcggctttagccatccgcaccaccctttctagatctcccgaaggttgctgcatcggtggactgtggttatt 9437165  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 1 - 54
Target Start/End: Complemental strand, 33758632 - 33758579
Alignment:
1 gtggtggtgtgacggtcggctttagccatccgcaccaccctttctagatctccc 54  Q
    ||||||||| ||||||||||||||||||||||||||| |||||| |||||||||    
33758632 gtggtggtgcgacggtcggctttagccatccgcaccatcctttccagatctccc 33758579  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 70; Significance: 1e-31; HSPs: 3)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 171 - 292
Target Start/End: Original strand, 15118245 - 15118366
Alignment:
171 atcctttgtgtgagtttggttttgggtggtcatagaccgccgacggcctttggtgtagttccaaggtggcggtggttcggtggtggatatgggttgtaca 270  Q
    ||||| |||| | |||||||||||||||||| |||||||| | | |||||||||||| ||||||||||||||||||| ||||||||||||||||||  ||    
15118245 atcctctgtgagtgtttggttttgggtggtcgtagaccgctggcagcctttggtgtaattccaaggtggcggtggtttggtggtggatatgggttgcgca 15118344  T
271 acaccctttctcggtggtgatg 292  Q
    ||||| ||||||||| ||||||    
15118345 acaccatttctcggtagtgatg 15118366  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 1 - 54
Target Start/End: Original strand, 15118080 - 15118133
Alignment:
1 gtggtggtgtgacggtcggctttagccatccgcaccaccctttctagatctccc 54  Q
    ||||||||||||||||||| |||||||||||||||||||||||| |||||||||    
15118080 gtggtggtgtgacggtcgggtttagccatccgcaccaccctttccagatctccc 15118133  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 2 - 46
Target Start/End: Complemental strand, 10004382 - 10004338
Alignment:
2 tggtggtgtgacggtcggctttagccatccgcaccaccctttcta 46  Q
    |||||||| ||||  ||||||||||||||| ||||||||||||||    
10004382 tggtggtgcgacgaacggctttagccatccacaccaccctttcta 10004338  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 59; Significance: 5e-25; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 194 - 292
Target Start/End: Complemental strand, 5052030 - 5051932
Alignment:
194 gggtggtcatagaccgccgacggcctttggtgtagttccaaggtggcggtggttcggtggtggatatgggttgtacaacaccctttctcggtggtgatg 292  Q
    |||||||| |||||||||  ||||||||||| || ||||||| ||||||||||| |||||| |||||||||||  ||||||||||||||||||||||||    
5052030 gggtggtcgtagaccgccagcggcctttggtataattccaagatggcggtggtttggtggttgatatgggttgcgcaacaccctttctcggtggtgatg 5051932  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 1 - 40
Target Start/End: Original strand, 7694669 - 7694708
Alignment:
1 gtggtggtgtgacggtcggctttagccatccgcaccaccc 40  Q
    ||||||||| |||||||| |||||||||||||||||||||    
7694669 gtggtggtgcgacggtcgactttagccatccgcaccaccc 7694708  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 47; Significance: 8e-18; HSPs: 3)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 1 - 83
Target Start/End: Complemental strand, 50590441 - 50590359
Alignment:
1 gtggtggtgtgacggtcggctttagccatccgcaccaccctttctagatctcccaaaggttgctgcatcggtgaactgtggtt 83  Q
    ||||||||| |||||||||||||||||||||||||||| ||||| |||||||||  ||||||  || |||||| |||||||||    
50590441 gtggtggtgcgacggtcggctttagccatccgcaccacactttccagatctcccggaggttgtcgcgtcggtggactgtggtt 50590359  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 184 - 247
Target Start/End: Complemental strand, 50590263 - 50590200
Alignment:
184 gtttggttttgggtggtcatagaccgccgacggcctttggtgtagttccaaggtggcggtggtt 247  Q
    |||||||||||||||||| |||||||||| |||||||||||||| ||||||||| |||| ||||    
50590263 gtttggttttgggtggtcgtagaccgccggcggcctttggtgtaattccaaggtagcggcggtt 50590200  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 1 - 53
Target Start/End: Original strand, 51406918 - 51406970
Alignment:
1 gtggtggtgtgacggtcggctttagccatccgcaccaccctttctagatctcc 53  Q
    ||||||||| ||||||||||||||||||||||||||| |||||| ||||||||    
51406918 gtggtggtgcgacggtcggctttagccatccgcaccatcctttccagatctcc 51406970  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 1 - 51
Target Start/End: Original strand, 51056081 - 51056131
Alignment:
1 gtggtggtgtgacggtcggctttagccatccgcaccaccctttctagatct 51  Q
    ||||||||| ||||||||||||||||||||| |||||||||||| ||||||    
51056081 gtggtggtgcgacggtcggctttagccatccacaccaccctttccagatct 51056131  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University