View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7323_high_12 (Length: 294)
Name: NF7323_high_12
Description: NF7323
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7323_high_12 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 268; Significance: 1e-150; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 268; E-Value: 1e-150
Query Start/End: Original strand, 15 - 286
Target Start/End: Complemental strand, 31590138 - 31589867
Alignment:
| Q |
15 |
acatcacaactgccttctgactctattctctcagtgacgagcagtagattttctgattggcaggaaacaaagtggtacgcaacaggccatcagagtggtg |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31590138 |
acatcacaactgccttctgactctattctctcagtgacgagcagtagattttctgattggcaggaaacaaagtggtacgcaacaggccatcagagtggtg |
31590039 |
T |
 |
| Q |
115 |
ctgtcaaagtgtggcaaatggttcactgctctgacccagatagctctctcagcaaatcaggtgcaggtgggttcagagtgttaaaccttggtgcaaaaga |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
31590038 |
ctgtcaaagtgtggcaaatggttcactgctctgacccagatagctctctcagcaaatcaggtgcaagtgggttcagagtgttaaaccttggtgcaaaaga |
31589939 |
T |
 |
| Q |
215 |
gccagaatacagattgatcctacgcaaggtactcaagttccataagcatccggttactgctcttcatctcac |
286 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31589938 |
gccagaatacagattgatcctacgcaaggtactcaagttccataagcatccggttactgctcttcatctcac |
31589867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University