View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7323_high_20 (Length: 230)
Name: NF7323_high_20
Description: NF7323
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7323_high_20 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 12 - 212
Target Start/End: Original strand, 27874836 - 27875036
Alignment:
| Q |
12 |
gtttggtgttattataatttatatatgatgaaatttgatcatgtcattgtttttgggtttcaggaggaaaaaagttcaaaatgtgtggtttgattcagta |
111 |
Q |
| |
|
||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27874836 |
gtttggtattattataatttatacatgatgaaatttgatcatgtcattgtttttgggtttcaggaggaaaaaagttcaaaatgtgtggtttgattcagta |
27874935 |
T |
 |
| Q |
112 |
tgtgaatctgtttggaattgcaattggatatactattgctgcctcagttagtatgatgtgagttgttgaaacttaagtttcattaattgttcattcttgt |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
27874936 |
tgtgaatctgtttggaattgcaattggatatactattgctgcctcagttagtatgatgtgagttgttaaaacttaagtttcattaattgttcattcttgt |
27875035 |
T |
 |
| Q |
212 |
t |
212 |
Q |
| |
|
| |
|
|
| T |
27875036 |
t |
27875036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University