View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7323_high_21 (Length: 229)

Name: NF7323_high_21
Description: NF7323
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7323_high_21
NF7323_high_21
[»] chr4 (1 HSPs)
chr4 (16-109)||(45331569-45331662)


Alignment Details
Target: chr4 (Bit Score: 94; Significance: 5e-46; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 16 - 109
Target Start/End: Original strand, 45331569 - 45331662
Alignment:
16 gattacaccttatttaaggattactagtgtcattctttgtagcaatttattagctataagtgttttgtttttgaaggattattagctataagtg 109  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
45331569 gattacaccttatttaaggattactagtgtcattctttgtagcaatttattagctataagtgttttgtttttgaaggattattagctataagtg 45331662  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University