View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7323_low_14 (Length: 347)
Name: NF7323_low_14
Description: NF7323
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7323_low_14 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 181; Significance: 9e-98; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 181; E-Value: 9e-98
Query Start/End: Original strand, 141 - 341
Target Start/End: Original strand, 41956059 - 41956259
Alignment:
| Q |
141 |
aaatacatagttgtcctataaattgtcaaacaaatgattgctcacaacttcacataacacaactcaattttaaaactatgcatttgatggctcattctct |
240 |
Q |
| |
|
|||||||||||| ||| ||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41956059 |
aaatacatagttatcccataaattgtcaaacaaatggttgttcacaacttcacataacacaactcaattttaaaactatgcatttgatggctcattctct |
41956158 |
T |
 |
| Q |
241 |
aatacaaacacttgtaatgtcattttatttttatattccaagtctttgttttatcagcttttatttaaaaaatgaaaattgaagcacttccttcttctct |
340 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
41956159 |
aatacaaacacttgtaatgtcattttatttttatattccaagtctttgttttatcagcttttatttaaaaaatgaaaattgaagcacttccttcatctct |
41956258 |
T |
 |
| Q |
341 |
g |
341 |
Q |
| |
|
| |
|
|
| T |
41956259 |
g |
41956259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University