View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7323_low_18 (Length: 306)
Name: NF7323_low_18
Description: NF7323
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7323_low_18 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 118; Significance: 3e-60; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 118; E-Value: 3e-60
Query Start/End: Original strand, 159 - 292
Target Start/End: Complemental strand, 9437092 - 9436959
Alignment:
| Q |
159 |
gcagatctgtaaatcctttgtgtgagtttggttttgggtggtcatagaccgccgacggcctttggtgtagttccaaggtggcggtggttcggtggtggat |
258 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
9437092 |
gcagatatgtaaatcctttgtgtgagtttggttttgggtggtcgtagaccgccgacggcctttggtgtagttccaaggtggcggtggtttggtggtggat |
9436993 |
T |
 |
| Q |
259 |
atgggttgtacaacaccctttctcggtggtgatg |
292 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||| |
|
|
| T |
9436992 |
atgggttgcacaacaccctttctcggtggtgatg |
9436959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 1 - 86
Target Start/End: Complemental strand, 9437250 - 9437165
Alignment:
| Q |
1 |
gtggtggtgtgacggtcggctttagccatccgcaccaccctttctagatctcccaaaggttgctgcatcggtgaactgtggttatt |
86 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||| |
|
|
| T |
9437250 |
gtggtggtgtgacggtcggctttagccatccgcaccaccctttctagatctcccgaaggttgctgcatcggtggactgtggttatt |
9437165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 1 - 54
Target Start/End: Complemental strand, 33758632 - 33758579
Alignment:
| Q |
1 |
gtggtggtgtgacggtcggctttagccatccgcaccaccctttctagatctccc |
54 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||| |||||| ||||||||| |
|
|
| T |
33758632 |
gtggtggtgcgacggtcggctttagccatccgcaccatcctttccagatctccc |
33758579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 70; Significance: 1e-31; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 171 - 292
Target Start/End: Original strand, 15118245 - 15118366
Alignment:
| Q |
171 |
atcctttgtgtgagtttggttttgggtggtcatagaccgccgacggcctttggtgtagttccaaggtggcggtggttcggtggtggatatgggttgtaca |
270 |
Q |
| |
|
||||| |||| | |||||||||||||||||| |||||||| | | |||||||||||| ||||||||||||||||||| |||||||||||||||||| || |
|
|
| T |
15118245 |
atcctctgtgagtgtttggttttgggtggtcgtagaccgctggcagcctttggtgtaattccaaggtggcggtggtttggtggtggatatgggttgcgca |
15118344 |
T |
 |
| Q |
271 |
acaccctttctcggtggtgatg |
292 |
Q |
| |
|
||||| ||||||||| |||||| |
|
|
| T |
15118345 |
acaccatttctcggtagtgatg |
15118366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 1 - 54
Target Start/End: Original strand, 15118080 - 15118133
Alignment:
| Q |
1 |
gtggtggtgtgacggtcggctttagccatccgcaccaccctttctagatctccc |
54 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||| ||||||||| |
|
|
| T |
15118080 |
gtggtggtgtgacggtcgggtttagccatccgcaccaccctttccagatctccc |
15118133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 2 - 46
Target Start/End: Complemental strand, 10004382 - 10004338
Alignment:
| Q |
2 |
tggtggtgtgacggtcggctttagccatccgcaccaccctttcta |
46 |
Q |
| |
|
|||||||| |||| ||||||||||||||| |||||||||||||| |
|
|
| T |
10004382 |
tggtggtgcgacgaacggctttagccatccacaccaccctttcta |
10004338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 59; Significance: 5e-25; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 194 - 292
Target Start/End: Complemental strand, 5052030 - 5051932
Alignment:
| Q |
194 |
gggtggtcatagaccgccgacggcctttggtgtagttccaaggtggcggtggttcggtggtggatatgggttgtacaacaccctttctcggtggtgatg |
292 |
Q |
| |
|
|||||||| ||||||||| ||||||||||| || ||||||| ||||||||||| |||||| ||||||||||| |||||||||||||||||||||||| |
|
|
| T |
5052030 |
gggtggtcgtagaccgccagcggcctttggtataattccaagatggcggtggtttggtggttgatatgggttgcgcaacaccctttctcggtggtgatg |
5051932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 1 - 40
Target Start/End: Original strand, 7694669 - 7694708
Alignment:
| Q |
1 |
gtggtggtgtgacggtcggctttagccatccgcaccaccc |
40 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
7694669 |
gtggtggtgcgacggtcgactttagccatccgcaccaccc |
7694708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 47; Significance: 8e-18; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 1 - 83
Target Start/End: Complemental strand, 50590441 - 50590359
Alignment:
| Q |
1 |
gtggtggtgtgacggtcggctttagccatccgcaccaccctttctagatctcccaaaggttgctgcatcggtgaactgtggtt |
83 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||| ||||| ||||||||| |||||| || |||||| ||||||||| |
|
|
| T |
50590441 |
gtggtggtgcgacggtcggctttagccatccgcaccacactttccagatctcccggaggttgtcgcgtcggtggactgtggtt |
50590359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 184 - 247
Target Start/End: Complemental strand, 50590263 - 50590200
Alignment:
| Q |
184 |
gtttggttttgggtggtcatagaccgccgacggcctttggtgtagttccaaggtggcggtggtt |
247 |
Q |
| |
|
|||||||||||||||||| |||||||||| |||||||||||||| ||||||||| |||| |||| |
|
|
| T |
50590263 |
gtttggttttgggtggtcgtagaccgccggcggcctttggtgtaattccaaggtagcggcggtt |
50590200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 1 - 53
Target Start/End: Original strand, 51406918 - 51406970
Alignment:
| Q |
1 |
gtggtggtgtgacggtcggctttagccatccgcaccaccctttctagatctcc |
53 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||| |||||| |||||||| |
|
|
| T |
51406918 |
gtggtggtgcgacggtcggctttagccatccgcaccatcctttccagatctcc |
51406970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 1 - 51
Target Start/End: Original strand, 51056081 - 51056131
Alignment:
| Q |
1 |
gtggtggtgtgacggtcggctttagccatccgcaccaccctttctagatct |
51 |
Q |
| |
|
||||||||| ||||||||||||||||||||| |||||||||||| |||||| |
|
|
| T |
51056081 |
gtggtggtgcgacggtcggctttagccatccacaccaccctttccagatct |
51056131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University