View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7323_low_20 (Length: 283)
Name: NF7323_low_20
Description: NF7323
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7323_low_20 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 206; Significance: 1e-113; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 17 - 226
Target Start/End: Original strand, 408592 - 408801
Alignment:
| Q |
17 |
agttagaaattaggaagcagtgttcacagatgtgtgatcagattaagagggccagcaaattttgggaaatttggatgaaaaccagtgtcacacttgcctt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
408592 |
agttagaaattaggaagcagtgttcacagatgtgtgatcagattaagagggccagcaaattttgggaaatttggatgaaaaccagtgtcacacttgcctt |
408691 |
T |
|
| Q |
117 |
catcttgtaacttcttaatgatactttataactttttatgtaatagacgtaaattttcccaaactctttgtaactttttgaagagttgaaactttaggga |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
408692 |
catcttgtaacttcttaatgatactttataactttttatgtaatagacgtaaattttctcaaactctttgtaactttttgaagagttgaaactttaggga |
408791 |
T |
|
| Q |
217 |
tagtttcaaa |
226 |
Q |
| |
|
|||||||||| |
|
|
| T |
408792 |
tagtttcaaa |
408801 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 228 - 270
Target Start/End: Original strand, 412871 - 412913
Alignment:
| Q |
228 |
ctaaatttaagatgtttgtatacaaacccttgttctatgatgt |
270 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
412871 |
ctaaatttaagatgtttgtatacaaacccttgttctataatgt |
412913 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University