View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7323_low_32 (Length: 228)
Name: NF7323_low_32
Description: NF7323
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7323_low_32 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 73; Significance: 2e-33; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 3 - 79
Target Start/End: Complemental strand, 43178952 - 43178876
Alignment:
| Q |
3 |
tgtatattttgattctcacaccaccttttgcaaaatacacaaaatgtgggcaaattcgttcaccggtaaagttgcat |
79 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
43178952 |
tgtatattttgattctcacaccaccttttgcaaaatacacaaaatgtgggcaaattcgttcactggtaaagttgcat |
43178876 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 146 - 228
Target Start/End: Complemental strand, 43178809 - 43178727
Alignment:
| Q |
146 |
atgttaaataaatgatatgatagatagaaaaaacattagtaagnnnnnnnnaattacaatgttattatgttaattgttatatt |
228 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
43178809 |
atgttaaataaatgatatgatagatagaaaaaacattagtaagttttttttaattacaatgttattatgttaattgttatatt |
43178727 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 3 - 57
Target Start/End: Complemental strand, 43173078 - 43173024
Alignment:
| Q |
3 |
tgtatattttgattctcacaccaccttttgcaaaatacacaaaatgtgggcaaat |
57 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||| | ||||||||||||||||| |
|
|
| T |
43173078 |
tgtatatttttattctcacaccaccttttgcaaaacatacaaaatgtgggcaaat |
43173024 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University