View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7324_high_3 (Length: 320)
Name: NF7324_high_3
Description: NF7324
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7324_high_3 |
 |  |
|
| [»] scaffold0035 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0035 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: scaffold0035
Description:
Target: scaffold0035; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 1 - 287
Target Start/End: Original strand, 76491 - 76781
Alignment:
| Q |
1 |
gcgccatcgacagtgaaacattcaagacaaagattcctgtcattacgtacgatgatgttcaaccagagattcagcgtatcgccaatggtgatcgctctcc |
100 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
76491 |
gcgccatcgaccgtgaaacattcaagacaaagattcctgtcatcacgtacgatgatgttcaaccagagattcagcgtatcgccaatggtgatcgctctcc |
76590 |
T |
 |
| Q |
101 |
aattctctctgctcatcccatctctgaattcctaacaaggtacccaannnnnnnnnnnnnnnnnggtggtggttggtgtttgaac--acct--tatatat |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||| || |||||||| |||| ||||||| |
|
|
| T |
76591 |
aattctctctgctcatcccatctctgaattcctaacaaggtacccaattttttcatcttttttttgtggtggtcggggtttgaacagaccttatatatat |
76690 |
T |
 |
| Q |
197 |
attacgcattgtctttgaccgaccaattttttcttcttttgtttagtcgttaattggtctaaaattttatctaaaacttcttttgacctac |
287 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
76691 |
attacgcattgtctttgacggaccaattttttcttcttttctttagtcgttaattggtctaaaattttatctaaaacttcttttgacctac |
76781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University