View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7324_low_7 (Length: 229)
Name: NF7324_low_7
Description: NF7324
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7324_low_7 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 46962426 - 46962648
Alignment:
| Q |
1 |
cagaggtggaaatatatccaaaatcgaatggtggaacccaaaaaccagtatcagggtcttagttttaaaggctcaagaaattgcacttgcttcactgtta |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
46962426 |
cagaggtggaaatatatccaaaatcgaatggtggaacccaaaaaccagtatcagggtcttagttttaaaggctcaagaaattgcacttgcttcacagtta |
46962525 |
T |
 |
| Q |
101 |
agggtctctgatacaagttacaactgaaatccatgcatgattcttctttaactaagtttatgttctaaggttaggtttgaatatttctaggatcttctgg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46962526 |
agggtctctgatacaagttacaactgaaatccatgcatgattcttctttaactaagtttatgttctaaggttaggtttgaatatttctaggatcttctgg |
46962625 |
T |
 |
| Q |
201 |
atataataggagactattgtttt |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
46962626 |
atataataggagactattgtttt |
46962648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 2 - 110
Target Start/End: Original strand, 25184903 - 25185009
Alignment:
| Q |
2 |
agaggtggaaatatatccaaaatcgaatggtggaacccaaaaaccagtatcagggtcttagttttaaaggctcaagaaattgcacttgcttcactgttaa |
101 |
Q |
| |
|
|||||||||| || |||| | |||||||| || |||||||| |||||||||||||||||||||| | ||| ||||||||||||| || |||| |||| |
|
|
| T |
25184903 |
agaggtggaagtagatccgacatcgaatgttgagacccaaaa-ccagtatcagggtcttagtttt-gatgctgaagaaattgcactcgcatcacaattaa |
25185000 |
T |
 |
| Q |
102 |
gggtctctg |
110 |
Q |
| |
|
||||||||| |
|
|
| T |
25185001 |
gggtctctg |
25185009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University