View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7325_high_32 (Length: 242)
Name: NF7325_high_32
Description: NF7325
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7325_high_32 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 16 - 242
Target Start/End: Complemental strand, 49910157 - 49909931
Alignment:
| Q |
16 |
atcccatttcatcaacgcaacaacgttccacatcatcttctcggcgacattgatccttctcaaggtgagttctcaccttcagatttccgccgccacgccg |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49910157 |
atcccatttcatcaacgcaacaacgttccacatcatcttctcggcgacattgatccttctcacggtgagttctcaccttcagatttccgccgccacgccg |
49910058 |
T |
 |
| Q |
116 |
gagatatcatctccgatattacttcccggagaaaacttcccattatcgttggtgggtccaactcattcattcacgctcttcttgtagaacgattcgaccc |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49910057 |
gagatatcatctccgatattacttcccggagaaaacttcccattatcgttggtgggtccaactcattcattcacgctcttcttgtagaacgattcgaccc |
49909958 |
T |
 |
| Q |
216 |
tgagtcaaacgttttcgacgagtcatc |
242 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
49909957 |
tgagtcaaacgttttcgacgagtcatc |
49909931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University