View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7325_high_39 (Length: 235)
Name: NF7325_high_39
Description: NF7325
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7325_high_39 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 13 - 216
Target Start/End: Original strand, 29564847 - 29565049
Alignment:
| Q |
13 |
gtgagatgaaattgaatatatattttacgtaactttctatcttgtttgtctccctcaagaacaataggactgagattctcttgggtttctcattgtgtcg |
112 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
29564847 |
gtgaaatgaaattgaatatatattttacgtaactttctatcttgtttgtctccctcaagaacaataggactgagattctcttgggtttctcattgt---g |
29564943 |
T |
 |
| Q |
113 |
tccattatac--attgatggcttaattatacgacataaatagctggagcaagtaatatttggaccaacatgcatgtttaaatatatacacagacacgaga |
210 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29564944 |
tccattatacatattgatggcttaattatacgacataaatagctggagcaagtaatatttggaccaacatgcatgtttaaatatatacacagacacgaga |
29565043 |
T |
 |
| Q |
211 |
cggaac |
216 |
Q |
| |
|
|||||| |
|
|
| T |
29565044 |
cggaac |
29565049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University