View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7325_low_32 (Length: 288)
Name: NF7325_low_32
Description: NF7325
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7325_low_32 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 255; Significance: 1e-142; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 8 - 270
Target Start/End: Complemental strand, 42622820 - 42622558
Alignment:
| Q |
8 |
ttggtgttagaggaggagatcaagaaactcttccaaatgtagctgttattatggaaacagatgaaggtatggaagcttgggtgacaatggaaatgcataa |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42622820 |
ttggtgttagaggaggagatcaagaaactcttccaaatgtagctgttattatggaaacagatgaaggtatggaagcttgggtgacaatggaaatgcataa |
42622721 |
T |
 |
| Q |
108 |
tatagcttacttggaaaatgatagggagtttctcaaatttgctttgcctaatccttgtgttacaaacatttagtttataatatatgcgaatgaatgaatt |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42622720 |
tatagcttacttggaaaatgatagggagtttctcaaatttgctttgcctaatccttgtgttacaaacatttagtttataatatatgcgaatgaatgaatt |
42622621 |
T |
 |
| Q |
208 |
agtggatgttttgttttgagaaatgattgaaattacacagctcgagaggaactaatattcctc |
270 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||| |
|
|
| T |
42622620 |
agtggatgttttgttttgagaaatgattgaaattacatagctcgataggaactaatattcctc |
42622558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University