View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7325_low_38 (Length: 246)
Name: NF7325_low_38
Description: NF7325
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7325_low_38 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 6 - 227
Target Start/End: Complemental strand, 18638696 - 18638468
Alignment:
| Q |
6 |
gtttggtggtgatgctaataatgtacgaatggtactgtcaacttcgtgggagaaaaagaaata--ctgctgtcaaaaacaaaaa-gtactgctgttactg |
102 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||| |||||| | |
|
|
| T |
18638696 |
gtttgatggtgatgctaataatgtacgaatggtactgtcaacttcgtgggagaaaaagaaatatactgctgtcaaaaacaaaaaagtactgatgttaccg |
18638597 |
T |
 |
| Q |
103 |
tgagtcatctatctatttttccatagtaaagaaggaacatattaattttcattc----gtcaccaacagtttgcagattgaatgtctaatgcatgtgcct |
198 |
Q |
| |
|
|||||||||| ||||||||||| |||| ||||||||| ||||||||||||| ||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
18638596 |
acagtcatctatttatttttccatggtaattaaggaacatgttaattttcattcatttgtcaccatcagtttgcagattgaatgtctaatgcatgtgcct |
18638497 |
T |
 |
| Q |
199 |
taattaatatattgaataaatcatgaagg |
227 |
Q |
| |
|
|||||||||||||| |||||||||||||| |
|
|
| T |
18638496 |
taattaatatattggataaatcatgaagg |
18638468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University