View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7325_low_42 (Length: 239)
Name: NF7325_low_42
Description: NF7325
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7325_low_42 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 18 - 231
Target Start/End: Complemental strand, 32224409 - 32224196
Alignment:
| Q |
18 |
caaatgcagcagcaacaaaaccatgatcatgatggatccgttgacccgacccgttgttgttgtctcctttcacgttgacaaaccctagctcatcttcaac |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32224409 |
caaatgcagcagcaacaaaaccatgatcatgatggatccgttgacccgacccgttgttgttgtctcctttcacgttgacaaaccctagctcatcttcaac |
32224310 |
T |
|
| Q |
118 |
acctgccatgaaaccacacgcctcggttttctgaaccacaactttcttcttaccttctccctcatccatcatcattgctatctatctactttctctttct |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32224309 |
acctgccatgaaaccacacgcctcggttttctgaaccacaactttcttcttaccttctccctcatccatcatcattgctatctatctactttctctttct |
32224210 |
T |
|
| Q |
218 |
ctctctttgtttct |
231 |
Q |
| |
|
||||||||| |||| |
|
|
| T |
32224209 |
ctctctttggttct |
32224196 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University