View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7325_low_43 (Length: 239)
Name: NF7325_low_43
Description: NF7325
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7325_low_43 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 102; Significance: 9e-51; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 102; E-Value: 9e-51
Query Start/End: Original strand, 18 - 119
Target Start/End: Complemental strand, 2512218 - 2512117
Alignment:
| Q |
18 |
gcaactttatatgttaagcattacttattttatggcttcatgggttattgttaattaattaatgattgatcgatggattccacaacttgagaaatagcta |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2512218 |
gcaactttatatgttaagcattacttattttatggcttcatgggttattgttaattaattaatgattgatcgatggattccacaacttgagaaatagcta |
2512119 |
T |
 |
| Q |
118 |
tc |
119 |
Q |
| |
|
|| |
|
|
| T |
2512118 |
tc |
2512117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 171 - 236
Target Start/End: Complemental strand, 2512065 - 2512000
Alignment:
| Q |
171 |
gttagtaggagttatgagttctctcatcctacattttgttttatatagttcacaatcatatttgat |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2512065 |
gttagtaggagttatgagttctctcatcctacattttgttttatatagttcacaatcatatttgat |
2512000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University