View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7325_low_46 (Length: 236)
Name: NF7325_low_46
Description: NF7325
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7325_low_46 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 9 - 217
Target Start/End: Original strand, 25117982 - 25118190
Alignment:
| Q |
9 |
agtgagaagaagaatgccaaacttgttaaagctttgaagggtcgtcaaatacatgcttgtgtgtctcttaatcaatcttgatgacttctattacttgagt |
108 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
25117982 |
agtgaaaagaagaatgccaaacttgttaaagctttgaagggtcgtcaaatacatgcttctgtgtctcttaatcaatcttgatgacttctattacttgatt |
25118081 |
T |
 |
| Q |
109 |
gtccaagccatcttctcattatacttttgtgttgcttcctgcttgagattattaaacatgtttttaaccatatacttaaggaagttattttgtagtagta |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
25118082 |
gtccaagccatcttctcattatacttttgtgttgcttcctgcttgagattattaaacatgtttttaaccatatacttaaggaagttattctgtagtagta |
25118181 |
T |
 |
| Q |
209 |
tgtatttag |
217 |
Q |
| |
|
||||||||| |
|
|
| T |
25118182 |
tgtatttag |
25118190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University