View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7325_low_52 (Length: 204)
Name: NF7325_low_52
Description: NF7325
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7325_low_52 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 20 - 191
Target Start/End: Original strand, 13212724 - 13212895
Alignment:
| Q |
20 |
cagacaccacgctgcctccttcgcgcaaagaccgtcacactttccatgatgtcacatccatttgcaacttccatcacgtgggatcggagtgcgttcgcgc |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13212724 |
cagacaccacgctgcctccttcgcgcaaagaccgtcacactttccatgatgtcacatccatttgcaacttccatcacgtgggatcggagtgcgttcgcgc |
13212823 |
T |
 |
| Q |
120 |
tgtccctcgtgatgatgataggtggttttggtttgtttttcgaacctgctggtcttcctcttggtcttcttc |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13212824 |
tgtccctcgtgatgatgataggtggttttggtttgtttttcgaacctgctggtcttcctcttggtcttcttc |
13212895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 45; Significance: 8e-17; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 110 - 190
Target Start/End: Original strand, 3332356 - 3332436
Alignment:
| Q |
110 |
gcgttcgcgctgtccctcgtgatgatgataggtggttttggtttgtttttcgaacctgctggtcttcctcttggtcttctt |
190 |
Q |
| |
|
||||| |||||||| | |||||||| || |||||||||||||||||||| || || |||||||||||||||||||||||| |
|
|
| T |
3332356 |
gcgtttgcgctgtcacgtgtgatgataatcggtggttttggtttgtttttggatccagctggtcttcctcttggtcttctt |
3332436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 37; Significance: 0.000000000005; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 140 - 188
Target Start/End: Complemental strand, 16578665 - 16578617
Alignment:
| Q |
140 |
ggtggttttggtttgtttttcgaacctgctggtcttcctcttggtcttc |
188 |
Q |
| |
|
|||||||||||||||||||| ||||| | |||||||||||||||||||| |
|
|
| T |
16578665 |
ggtggttttggtttgttttttgaaccgggtggtcttcctcttggtcttc |
16578617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 136 - 188
Target Start/End: Original strand, 32803226 - 32803278
Alignment:
| Q |
136 |
gataggtggttttggtttgtttttcgaacctgctggtcttcctcttggtcttc |
188 |
Q |
| |
|
|||||||||||||||| ||||||| || || | |||||||||||||||||||| |
|
|
| T |
32803226 |
gataggtggttttggtctgtttttggatccaggtggtcttcctcttggtcttc |
32803278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 122 - 159
Target Start/End: Complemental strand, 46200969 - 46200932
Alignment:
| Q |
122 |
tccctcgtgatgatgataggtggttttggtttgttttt |
159 |
Q |
| |
|
||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
46200969 |
tcccttgtgatgataataggtggttttggtttgttttt |
46200932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University