View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7325_low_52 (Length: 204)

Name: NF7325_low_52
Description: NF7325
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7325_low_52
NF7325_low_52
[»] chr8 (1 HSPs)
chr8 (20-191)||(13212724-13212895)
[»] chr5 (1 HSPs)
chr5 (110-190)||(3332356-3332436)
[»] chr1 (2 HSPs)
chr1 (140-188)||(16578617-16578665)
chr1 (136-188)||(32803226-32803278)
[»] chr3 (1 HSPs)
chr3 (122-159)||(46200932-46200969)


Alignment Details
Target: chr8 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 20 - 191
Target Start/End: Original strand, 13212724 - 13212895
Alignment:
20 cagacaccacgctgcctccttcgcgcaaagaccgtcacactttccatgatgtcacatccatttgcaacttccatcacgtgggatcggagtgcgttcgcgc 119  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
13212724 cagacaccacgctgcctccttcgcgcaaagaccgtcacactttccatgatgtcacatccatttgcaacttccatcacgtgggatcggagtgcgttcgcgc 13212823  T
120 tgtccctcgtgatgatgataggtggttttggtttgtttttcgaacctgctggtcttcctcttggtcttcttc 191  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
13212824 tgtccctcgtgatgatgataggtggttttggtttgtttttcgaacctgctggtcttcctcttggtcttcttc 13212895  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 45; Significance: 8e-17; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 110 - 190
Target Start/End: Original strand, 3332356 - 3332436
Alignment:
110 gcgttcgcgctgtccctcgtgatgatgataggtggttttggtttgtttttcgaacctgctggtcttcctcttggtcttctt 190  Q
    ||||| |||||||| |  |||||||| || |||||||||||||||||||| || || ||||||||||||||||||||||||    
3332356 gcgtttgcgctgtcacgtgtgatgataatcggtggttttggtttgtttttggatccagctggtcttcctcttggtcttctt 3332436  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 37; Significance: 0.000000000005; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 140 - 188
Target Start/End: Complemental strand, 16578665 - 16578617
Alignment:
140 ggtggttttggtttgtttttcgaacctgctggtcttcctcttggtcttc 188  Q
    |||||||||||||||||||| ||||| | ||||||||||||||||||||    
16578665 ggtggttttggtttgttttttgaaccgggtggtcttcctcttggtcttc 16578617  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 136 - 188
Target Start/End: Original strand, 32803226 - 32803278
Alignment:
136 gataggtggttttggtttgtttttcgaacctgctggtcttcctcttggtcttc 188  Q
    |||||||||||||||| ||||||| || || | ||||||||||||||||||||    
32803226 gataggtggttttggtctgtttttggatccaggtggtcttcctcttggtcttc 32803278  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 122 - 159
Target Start/End: Complemental strand, 46200969 - 46200932
Alignment:
122 tccctcgtgatgatgataggtggttttggtttgttttt 159  Q
    ||||| |||||||| |||||||||||||||||||||||    
46200969 tcccttgtgatgataataggtggttttggtttgttttt 46200932  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University