View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7326_high_7 (Length: 268)
Name: NF7326_high_7
Description: NF7326
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7326_high_7 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 95; Significance: 1e-46; HSPs: 4)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 64 - 209
Target Start/End: Complemental strand, 32357192 - 32357047
Alignment:
| Q |
64 |
atattatccagcttctagtgattgataatcacaatcttagtctctagacatgttttggaggaa-aaaataagctgacccactcaaggctatttgacataa |
162 |
Q |
| |
|
|||||||||||||||||||||| |||| ||||||||||||| ||||||||||||||||||||| ||||||| |||| |||||||||| |||||||||| | |
|
|
| T |
32357192 |
atattatccagcttctagtgatagatagtcacaatcttagtttctagacatgttttggaggaaaaaaataacctga-ccactcaaggttatttgacatca |
32357094 |
T |
|
| Q |
163 |
taaattgagaatattaaacaatctcacaatgttacaacacttccttt |
209 |
Q |
| |
|
||||||| ||||||| ||| ||||||||||||||||||||||||||| |
|
|
| T |
32357093 |
taaattgtgaatattgaaccatctcacaatgttacaacacttccttt |
32357047 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 77; E-Value: 8e-36
Query Start/End: Original strand, 154 - 255
Target Start/End: Complemental strand, 32371536 - 32371429
Alignment:
| Q |
154 |
ttgacataataaattgagaatattaaacaatctcacaatgttacaacacttcctttc------gagcctcactataatactaaggttgttgccttctgac |
247 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||| |
|
|
| T |
32371536 |
ttgacataataaattgtgaatattaaacaatctcacaatgttacaacacttcctttcgagggagagcctcagtataatactaaggttgttgccttctgac |
32371437 |
T |
|
| Q |
248 |
ctagatat |
255 |
Q |
| |
|
|||||||| |
|
|
| T |
32371436 |
ctagatat |
32371429 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 50 - 114
Target Start/End: Complemental strand, 32371594 - 32371530
Alignment:
| Q |
50 |
ccttctagtgaacgatattatccagcttctagtgattgataatcacaatcttagtctctagacat |
114 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||| ||||| |
|
|
| T |
32371594 |
ccttctagtgatcgatattatccagcttctagtgatcgataatcacaatcttagtctcttgacat |
32371530 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 73 - 154
Target Start/End: Original strand, 32364860 - 32364939
Alignment:
| Q |
73 |
agcttctagtgattgataatcacaatcttagtctctagacatgttttggaggaaaaaataagctgacccactcaaggctatt |
154 |
Q |
| |
|
||||||||||||| |||| | | ||||||| | ||||||| ||||||||||||||||||| ||||||||||||||| |||| |
|
|
| T |
32364860 |
agcttctagtgatagatagttagaatcttaatttctagac--gttttggaggaaaaaataacctgacccactcaaggttatt |
32364939 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University