View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7326_high_9 (Length: 260)
Name: NF7326_high_9
Description: NF7326
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7326_high_9 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 63 - 244
Target Start/End: Original strand, 27034522 - 27034702
Alignment:
| Q |
63 |
ggtattacattcatgaatacaatttgtttcggtttagnnnnnnngaatctgaaatttgataggttcaatggcatcgnnnnnnngtattacattcatgcta |
162 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
27034522 |
ggtattacattcatgaatacaatttgtttcggtttagaaaaaa-gaatctgaaatttgataggttcaatggcatcgaaaaaaagtattacattcatgcta |
27034620 |
T |
 |
| Q |
163 |
cattgttttttcatgttactgtcttttacttcctgccaaatttactatgaagcacagacacaggcattggcatcgaacacga |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27034621 |
cattgttttttcatgttactgtcttttacttcctgccaaatttactatgaagcacagacacaggcattggcatcgaacacga |
27034702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University