View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7326_low_7 (Length: 335)
Name: NF7326_low_7
Description: NF7326
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7326_low_7 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 177; Significance: 2e-95; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 108 - 327
Target Start/End: Complemental strand, 40853985 - 40853765
Alignment:
| Q |
108 |
agggtacatgttgaaaagttcaagatagaaatattactccctctaaataggg-tacttgttttggatgttttacacatgcaaatataaccaataaattta |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
40853985 |
agggtacatgttgaaaagttcaagatagaaatattactccctctatttttttatacttgttttggatgttttacacatgcaaagataaccaataaattta |
40853886 |
T |
|
| Q |
207 |
cttacttttgatattattatttctcttttcatataataatatctttaaccaaaaattgggttcaggtggtgaatgagttccatcaaaaaacgaattgttt |
306 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40853885 |
cttacttttgatattattatttctcttttcatataataatatctttaaccaaaaattaggttcaggtggtgaatgagttccatcaaaaaacgaattgttt |
40853786 |
T |
|
| Q |
307 |
atgagaacctagattcatttc |
327 |
Q |
| |
|
||||||||||| ||||||||| |
|
|
| T |
40853785 |
atgagaacctaaattcatttc |
40853765 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 104; E-Value: 8e-52
Query Start/End: Original strand, 1 - 108
Target Start/End: Complemental strand, 40854242 - 40854135
Alignment:
| Q |
1 |
aagctcataatggctcaccatgcaaatgaattgttggtttgttggaaaatgaattaatcgactgatctctgctttttgcaaataaaaaatagggtttgct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40854242 |
aagctcataatggctcaccatgcaaatgaattgttggtttgttggaaaatgaattaatcgactgatctctgctttttgcaaataaaaaatagggtttgct |
40854143 |
T |
|
| Q |
101 |
aaaaaata |
108 |
Q |
| |
|
|| ||||| |
|
|
| T |
40854142 |
aacaaata |
40854135 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University