View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7327_low_3 (Length: 206)
Name: NF7327_low_3
Description: NF7327
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7327_low_3 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 134; Significance: 6e-70; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 134; E-Value: 6e-70
Query Start/End: Original strand, 27 - 172
Target Start/End: Original strand, 36854520 - 36854665
Alignment:
| Q |
27 |
ttgctcttgacacaaatggttcaggttttaccgtcatataaaatttaacatttcatatttttaaatatatagtttgtattttcatgtgcttacttaactg |
126 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36854520 |
ttgctcttgacacaaatagttcaggttttaccgtcatatacaatttaacgtttcatatttttaaatatatagtttgtattttcatgtgcttacttaactg |
36854619 |
T |
|
| Q |
127 |
gtaaattggattacatgtatttcgtgtattaatacattcaattgca |
172 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36854620 |
gtaaattggattacatgtatttcgtgtattaatacattcaattgca |
36854665 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 29 - 171
Target Start/End: Complemental strand, 37368144 - 37368001
Alignment:
| Q |
29 |
gctcttgacacaaatggttcaggttttaccgtcatataa-aatttaacatttcatatttttaaatatatagtttgtattttcatgtgcttacttaactgg |
127 |
Q |
| |
|
|||||| |||||||| |||||||||||| ||||||||| | ||||| ||||||| |||| ||||| |||| | ||| ||| |||||||| ||| || |
|
|
| T |
37368144 |
gctcttaacacaaatagttcaggttttaatgtcatataatattttaatgtttcatacttttgaatatctagtctatatcgtcacatgcttactaaaccgg |
37368045 |
T |
|
| Q |
128 |
taaattggattacatgtatttcgtgtattaatacattcaattgc |
171 |
Q |
| |
|
|||||| || ||| ||||| |||| |||||||||||||||| |
|
|
| T |
37368044 |
taaattagagaacacacatttcttgtactaatacattcaattgc |
37368001 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University